SGN Marker T0487

SGN-M1441
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.05.03
Tomato EST read: TCABA19TH
Arabidopsis best BAC match: AL049500.1
Arabidopsis position: 4.0730000
Arabidopsis identities: 0.736
Best GenBank protein hit: AAC64171.1
Evalue: 2e-113
Identities: 1.000
Description: pathogenesis-related protein osmotin precursor (Lycopersicon esculentum)
Comment: osmotin: antifungal activity
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49514)
Chromosome
8
Position
61.05 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47448)
Chromosome
8
Position
87.90 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39348)
Chromosome
8
Position
69.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0487 was used as an overgo probe on plate 12 [well B12]

Plausible BAC Matches:   P172B13,   P097D15,   P235H18

 Overgo Sequences

A sequence
ACCTGGAGGATGTAACAACCCTTG
B sequence
TCCTCCAAACGTGGTACAAGGGTT
AB sequence
ACCTGGAGGATGTAACAACCCTTGTACCAC
Marker sequence
CAAACATGGGCTACTTGACATCTTCTTTTGTTCTCTTCTTCCTTCTTTGT
GTGACTTATACTTATGCTGCCACTATTGAGGTACGCAACAACTGTCCATA
CACCGTTTGGGCGGCATCGACTCCGATAGGCGGTGGTCGACGTCTCAATC
GAGGCCAAACATGGGTCATCAATGCTCCGAGGGGAACTAAGATGGCACGT
ATATGGGGTCGTACTGGTTGCAACTTTAATGCTGCAGGCAGAGGTACATG
TCAGACTGGTGATTGTGGTGGAGTCTTACAGTGTACCGGATGGGGCAAAC
CCCCAAACACCCTAGCCGAGTACGCCTTGGACCAGTTTAGCAACTTAGAT
TTTTGGGACATTTCTTTAGTCGATGGATTTAATATTCCAATGACTTTTGC
CCCAACAAAACCTAGTGGAGGAAAATGTCACGCAATTCATTGCACGGCCA
ATATAAATGGTGAATGTCCTCGCGCCCTTAAGGTACCTGGAGGATGTAAC
AACCCTTGTACCACGTTTGGAGGACAACAATATTGTTGCACCCAAGGTCC
ATGTGG
Genomic location of T0487  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1441 marker 1441
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)