SGN Marker TES88

SGN-M14419

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49757)
Chromosome
2
Position
49.26 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47691)
Chromosome
2
Position
156.68 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45629
Forward primer (5'-3')
GCATGTTGTGGCACTACGACC
Accessions and product sizes
Solanum pennellii LA716
270
Solanum lycopersicum LA925
272
Approximate temperature
55°C
Reverse primer (5'-3')
AGCTGCTTGCACAGATGATG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES88  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14419 marker 14419
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)