SGN Marker T0493

SGN-M1444
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.03.04
Tomato EST read: TCAAY49TH
Arabidopsis best BAC match: AL031018.1
Arabidopsis position: 4.1180000
Arabidopsis identities: 0.775
Best GenBank protein hit: CAB79248.1
Evalue: 1.0e-90
Identities: 0.801
Description: dihydroorotase [Arabidopsis thaliana]
Comment: third step in pyrmidine biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39349)
Chromosome
2
Position
48.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0493 was used as an overgo probe on plate 12 [well C3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACGATTGAAGGTCGTGATGGAGCA
B sequence
ATCCATGGTGGTGACATGCTCCAT
AB sequence
ACGATTGAAGGTCGTGATGGAGCATGTCAC
Marker sequence
CAGGGTTCATGGAGAGGTTACTAATCCTGAGGTTGACATGTTTGATAGAG
AAAAGGTATTCATTGAAACGGTTCTAAGACCTTTGGTGCAGAAATTTCCA
CGATTGAAGGTCGTGATGGAGCATGTCACCACCATGGATGCTGTTAAGTT
TGTTGAATCTTGCAGTGAAGGATTTGTTGCAGCGACTGTCACCCCACAAC
ATCTTGTTTTAAACAGGAATTCTCTCTTCCAAGGGGGCTTACAACCGCAT
AATTACTGCCTTCCAGTCCTCAAAAGAGAGATCCACAGGGAGGCACTTGT
GTCAGCTGTAACAAGTGGAAGTAAAAGATTTTTTCTTGGGACTGATAGTG
CTCCTCATGATAGACGAAGAAAAGAATGTTCTTGTGGATGTGCTGGTATT
TACAATGCTCCTGTAGCCTTATCAGTATATGCAAAGGTGTTTGAAAAGGA
AAATGCACTTGACAAGCTCGAAGCATTTACCAGCTTCAATGGACCAGACT
TTTATGGGCTTCCGAGGAACAACTCAAAGATTAAGTTGAGTAAGACACCA
TGGAAGGTACCCGAATCCTTTTCATATGCATCA
Genomic location of T0493  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1444 marker 1444
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)