SGN Marker TES158

SGN-M14451

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47723)
Chromosome
12
Position
25.89 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45228
Forward primer (5'-3')
TTCACACCAAAAATCCATAAAAA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GGAAATGGGGTTTGGTTCT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES158  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14451 marker 14451
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)