Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker TES178

SGN-M14463

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49800)
Chromosome
7
Position
1.45 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47735)
Chromosome
7
Position
1.50 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45297
Forward primer (5'-3')
GGAGGGATCGTCATCGTCTA
Accessions and product sizes
Solanum pennellii LA716
300
Solanum lycopersicum LA925
294
Approximate temperature
55°C
Reverse primer (5'-3')
TTGGCTTTAATTGTCCAGCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES178  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14463 marker 14463
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)