SGN Marker T0507

SGN-M1449
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.07.1
Tomato EST read: TCABD46TH
Arabidopsis best BAC match: AB005237.1
Arabidopsis position: 5.0090000
Arabidopsis identities: 0.800
Best GenBank protein hit: CAA60794.1
Evalue: 2.5e-50
Identities: 0.740
Description: CYP90 protein [Arabidopsis thaliana]
Comment: Cyt P450 involved in brassinosteroid biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39351)
Chromosome
6
Position
25.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35588
Forward primer (5'-3')
CCTTTTATCTCCTCCGGTGT
Digested band sizes (using DraI)
Solanum lycopersicum LA925: 700
Solanum pennellii LA716: 800
Mg+2 concentration
3mM
Reverse primer (5'-3')
TCTGTCCACTCACATGGATCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 79
Forward primer (5'-3')
Unknown
Digested band sizes (using DraI)
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 700
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T0507 was used as an overgo probe on plate 2 [well E8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CGACCCATGTTTTTGGTGAACCGA
B sequence
TCAGCAGAGAAAACCGTCGGTTCA
AB sequence
CGACCCATGTTTTTGGTGAACCGACGGTTT
Marker sequence
CTCTATCTTTTTCTCTCTGTTTTCACCTTTTATCTCCTCCGGTGTATGGC
GGCGGCCCATCTTCGCGGGCGTAAAACTCGACTCCCGCCGGGAACCCTTG
GCCTCCCGTTTATCGGAGAAACCCTCCAGTTAATTTCTGCGTACAAAACG
GAAAATCCTGAACCGTTCATCGATGACCGTGTTTCAAAATACGGCAGCAT
TTTCACGACCCATGTTTTTGGTGAACCGACGGTTTTCTCTGCTGACCCGG
AAACGAACCGGTTTATTTTGCAGAATGAAGGTCGGCTTTTTGAGTCGAGT
TATCCCGGTTCGATACAGAATTTACTTGGGAGATACTCTCTGTTGCTTAT
GAGAGGAAGTCTACACAAACGAATGCATTCATTAACTATGAGTTTTGCTA
ATTCTTCCAT
Genomic location of T0507  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1449 marker 1449
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)