Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TES289

SGN-M14501

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49838)
Chromosome
8
Position
54.39 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47773)
Chromosome
8
Position
38.06 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45398
Forward primer (5'-3')
GGGGAGTCGTGGGATTATTT
Accessions and product sizes
Solanum lycopersicum LA925
278
Solanum pennellii LA716
275
Approximate temperature
55°C
Reverse primer (5'-3')
ATCTCAGAAGGCGCAGTGTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES289  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14501 marker 14501
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)