Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TES292

SGN-M14503

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49840)
Chromosome
6
Position
37.76 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47775)
Chromosome
6
Position
45.72 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45400
Forward primer (5'-3')
GTCTGCACCAAAGAATCAATCA
Accessions and product sizes
Solanum lycopersicum LA925
297
Solanum pennellii LA716
307
Approximate temperature
55°C
Reverse primer (5'-3')
AAGCTCTTTTGTGGGCTGAG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES292  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14503 marker 14503
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)