SGN Marker T0513

SGN-M1451
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TCABD91TH
Arabidopsis best BAC match: AC002505.2
Arabidopsis position: 2.1490000
Arabidopsis identities: 0.717
Best GenBank protein hit: AAF98368.1
Evalue: 2.4e-46
Identities: 0.908
Description: patatin-like protein 1 [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39352)
Chromosome
4
Position
108.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0513 was used as an overgo probe on plate 6 [well H2]

Plausible BAC Matches:   P027N01,   P233E24

 Overgo Sequences

A sequence
TGATGGAGGTGGCATTCGAGGAAT
B sequence
GATGGTAGCTGGAATAATTCCTCG
AB sequence
TGATGGAGGTGGCATTCGAGGAATTATTCC
Marker sequence
TAATTATTCATTTAGAATAAAGTTTTCTTATACCTTCTTTTGATTATCTA
TTAATCATTACAAATGGAGAGAAAAACATCTCAAATCCAACCACCAACTT
ATGGAGATTTCATCACTATTCTTAGTATTGATGGAGGTGGCATTCGAGGA
ATTATTCCAGCTACCATCCTCACTTTTCTTGAATCACAACTTCAGGAGTT
GGATGGAAAAAATGCAAGAATTGCAGATTACTTTGATGTTATTGCCGGAA
CTAGCACCGGTGGCCCTGTTACGGCCATGTTAACGGCTCCAGATGAAAAT
CATCGTCCACTTTATGCTGCTAAGGATATTACACCGTTCTATTTAGAGCA
TTGTCC
Genomic location of T0513  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1451 marker 1451
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)