SGN Marker T0521

SGN-M1453
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.05.03
Tomato EST read: TCABI71TH
Arabidopsis best BAC match: AB025639.1
Arabidopsis position: 3.0800000
Arabidopsis identities: 0.816
Best GenBank protein hit: BAB01311.1
Evalue: 1.2e-37
Identities: 0.765
Description: contains similarity to unknown [Arabidopsis thaliana]
Comment: similar match with IAA-alanine resistance protein 1 [Arabidopsis thaliana]
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39353)
Chromosome
9
Position
111.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0521 was used as an overgo probe on plate 14 [well C9]

Plausible BAC Matches:   P312H21

 Overgo Sequences

A sequence
AAAGGTGAGGTCCCAAGAGGTCTA
B sequence
TTTCTGCCCAATCTGGTAGACCTC
AB sequence
AAAGGTGAGGTCCCAAGAGGTCTACCAGAT
Marker sequence
AAACAGTCGGCGCAGTTTCAAAATTTTATGTAAATCACAACAGAAGAAGA
AGAAGATGAAGGGAAAAACAGAGAATGATGAAGAAGGAGCAAAAGGGGTT
GTGACTCTTGAAGAGCTGAAGAAAAAAATGGCTGATTTTGCTAAAGAAAG
AGAGTGGGATCAGTTTCATACACCAAGAAATCTCCTTTTAGCTATGGTGG
GTGAAGTGGGAGAATTGTCTGAAATATTTCAGTGGAAAGGTGAGGTCCCA
AGAGGTCTACCAGATTGGGCAGAAAAAGAGAAGCAGCATTTAGGTGAAGA
GCTATCAGATGTATTGCTTTATCTTGTCAGGCTTTCAGATATTTGTGGCA
TTGATCTAGGTAATGCT
Genomic location of T0521  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1453 marker 1453
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)