SGN Marker TES426

SGN-M14552

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49889)
Chromosome
11
Position
1.61 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47824)
Chromosome
11
Position
17.20 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45458
Forward primer (5'-3')
TTTGAGGAGGGCTGAAGAGA
Accessions and product sizes
Approximate temperature
55°C
Reverse primer (5'-3')
GCAGGATAACAGCCTCTTGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES426  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14552 marker 14552
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)