SGN Marker T0529

SGN-M1459
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TCABM08TH
Arabidopsis best BAC match: AC012563.5
Arabidopsis position: 1.1331000
Arabidopsis identities: 0.891
Best GenBank protein hit: AAF16552.1
Evalue: 7.7e-39
Identities: 0.714
Description: unknown protein; 23065-20358 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Eggplant-COSII   
Map version
63 (location: 42377)
Chromosome
11
Position
86.40 cM
Confidence
I
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39356)
Chromosome
4
Position
8.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10590)
Chromosome
11
Position
87.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0529 was used as an overgo probe on plate 1 [well E12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACTGATGGGATGGCTTTGGGAAGT
B sequence
CATGAAGGAGGAATGCACTTCCCA
AB sequence
ACTGATGGGATGGCTTTGGGAAGTGCATTC
Marker sequence
CTACGGAAGAGGAATACTGGCTCCAGTGCTGCTGAAGACAATACTGCTTT
AGATGCTGCAAATTGCTCTACCAATTCTACATCAACTGGAGAGGAACAGG
CTAAATCACGTTCAAGCCTTGTCTTTGGTTATCTCAACCTCTTTTCTGAT
GGTGTTCACAATTTTACTGATGGGATGGCTTTGGGAAGTGCATTCCTCCT
TCATGGATCAGTTGGTGGGTGGTCAAGAACTTTGTTTCTTCTGGCACATG
AGCTCCCTCAAGAGATAGGTGATTTTGGAATCTTGGTAAGGTCTGGGTTC
AGCGTCTCCAAAGCTCTCTTCTTTAACTTCTTATCTGCACTAGTGGCCCT
AGCCGGAACTGCACTGGCATTGACATTGGGGGGGGAAACCCC
Genomic location of T0529  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1459 marker 1459
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)