SGN Marker T0532

SGN-M1461
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.01
Tomato EST read: TCABK25TH
Arabidopsis best BAC match: AC006919.5
Arabidopsis position: 2.2000000
Arabidopsis identities: 0.969
Best GenBank protein hit: CAA41115.1
Evalue: 3.7e-58
Identities: 1.000
Description: enolase [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49516)
Chromosome
9
Position
2.37 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47450)
Chromosome
9
Position
28.68 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39357)
Chromosome
9
Position
30.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0532 was used as an overgo probe on plate 15 [well C4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACAACCAGCTGTTGAGGATCGAAG
B sequence
TCTGATCCGAGTTCCTCTTCGATC
AB sequence
ACAACCAGCTGTTGAGGATCGAAGAGGAAC
Marker sequence
CACCAACCCTAAGAGGGTCGCCAAGGCAATTGCAGAGAAGACTTGCAATG
CTCTTCTTCTCAAGGTTAACCAAATCGGTAGTGTGACCGAGAGTATTGAA
GCTGTGAAGATGTCCAAGAAGGCAGGTTGGGGTGTAATGACCAGTCACCG
CAGTGGAGAAACAGAAGATACCTTCATTGCTGATCTTGCTGTCGGTTTGT
CAACGGGACAAATCAAGACTGGAGCTCCTTGCAGGTCAGAGCGTCTCGCC
AAGTACAACCAGCTGTTGAGGATCGAAGAGGAACTCGGATCAGAGGCTGT
TTATGCAGGAGCAAGCTTCCGCAAGCCCGTTGAGCCCTACTAAATTTCAG
CAGTTCCAAGTGTTGAGATTGTTGAGTTGTTGATCTGCCAAAAATAAATT
CCTCTTAGATTGGTCATTTTAGGATTATATTATATGACCTTGGTGAAATA
ACAAGCAGACTC
Genomic location of T0532  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1461 marker 1461
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)