SGN Marker TG15

SGN-M147

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
2200
Vector
pUC
Cutting Site
EcoR1
Drug Resistance
AMP
Image
Forward sequence
ATCTCAACAAAGAAATATCACATAACTGCAATGACCAAAGATATCATGCAAGGAAATCAAGGGAGAAGAACCTGCGGAAAAATAAATAGG
AACTTTAAGATTCATCCGCTCCCAATAGTCATCCAATAACATACAGAGTTCCTGTTTGGAGAAGTATAGTTCACCAATAAAACAAATATT
TGTGTTATAATATCTTACAGTACAGAAGAAAAGAAAATCGTAAGAAGCAGCACGAACATAAAGAAAAACATCAAAAATAAGATTGAGGAA
AGCCCATGTTTATCAGTTATATAATTCGGCAACTTATACCACACATGTATAGATCATAAGCAGTGATAAGTGTGAGATATAGAGAACCTC
TAGACTTAGAAAACTCATAATTTTCCTTATTTATTTAATATTAGAGTGAAACTAGTGCAGATAGAGTGAAATAGATATAGAGATTCATAC
TCACTGACCACAAGTTTGGAATCGAG
Reverse sequence
TTTTATTTACTCTTGCTTTAATACCAAAAATTGATAATTTTTTAGATTCACAAATGTGTTGATAGCGGAGGAAAGGTGCTCATCCCTGCA
TTTGCTCTTGGAAGAGCTCAGGTTTTTATTCTTTATTTTGGCTACTTTATAAATCAAGTCTATTTTTTTTTTCCTTTTTTCTTTTTGATA
ACTGTGGTGTCTGGGCTAGCTTGTGCGTATCTCAACTAATTCTACTGGATACTTATCAATAGGGGTGGGTGTTCGGTTCTTCAGTTCAAT
TTTATCAAACTTTGATTCGGTTGTTTGGTTATGGAAACATGTGCAACAAACACCGAACCAATTTAGTTCAGTTTTTCAAAGTTTGTTCAA
TTTGGTCTTCTGAAACGTTTTCTCGACGCAAATGAGAAACAAAATAAGGACCAAACCAGAATAAATCTAACGTTAATACTATAATTATAC
CAATATATGGTACTAAATTACTAATTAGACC
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53184)
Chromosome
4
Position
15.25 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Maturity_4 MQTL_1_Late_blight_5.2 MQTL_2_Late_blight_4
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50346)
Chromosome
4
Position
1.69 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48281)
Chromosome
4
Position
6.40 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Sun1642 x LA1589   
Map version
85 (location: 43835)
Chromosome
4
Position
22.30 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43295)
Chromosome
4
Position
21.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40819)
Chromosome
4
Position
12.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39910)
Chromosome
4
Position
6.50 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8304)
Chromosome
4
Position
6.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8308)
Chromosome
4
Position
0.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8307)
Chromosome
4
Position
0.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG15 was used as an overgo probe on plate 9 [well C12]

Plausible BAC Matches:   P078J04,   P227B24

 Overgo Sequences

A sequence
GATATCATGCAAGGAAATCAAGGG
B sequence
TTCCGCAGGTTCTTCTCCCTTGAT
AB sequence
GATATCATGCAAGGAAATCAAGGGAGAAGA
Marker sequence
ATCTCAACAAAGAAATATCACATAACTGCAATGACCAAAGATATCATGCA
AGGAAATCAAGGGAGAAGAACCTGCGGAAAAATAAATAGGAACTTTAAGA
TTCATCCGCTCCCAATAGTCATCCAATAACATACAGAGTTCCTGTTTGGA
GAAGTATAGTTCACCAATAAAACAAATATTTGTGTTATAATATCTTACAG
TACAGAAGAAAAGAAAATCGTAAGAAGCAGCACGAACATAAAGAAAAACA
TCAAAAATAAGATTGAGGAAAGCCCATGTTTATCAGTTATATAATTCGGC
AACTTATACCACACATGTATAGATCATAAGCAGTGATAAGTGTGAGATAT
AGAGAACCTCTAGACTTAGAAAACTCATAATTTTCCTTATTTATTTAATA
TTAGAGTGAAACTAGTGCAGATAGAGTGAAATAGATATAGAGATTCATAC
TCACTGACCACAAGTTTGGAATCGAG
Genomic location of TG15  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D147 marker 147
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)