SGN Marker T0556

SGN-M1470
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TMEAA01TH
Arabidopsis best BAC match: U93215.2
Arabidopsis position: 2.1730000
Arabidopsis identities: 0.636
Best GenBank protein hit: AAB63080.1
Evalue: 5.7e-27
Identities: 0.606
Description: photosystem II reaction center 6.1KD protein[Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49517)
Chromosome
9
Position
59.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47451)
Chromosome
9
Position
54.46 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39358)
Chromosome
9
Position
53.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0556 was used as an overgo probe on plate 1 [well F4]

Plausible BAC Matches:   P199E03,   P259G13,   P116F03,   P208I09,   P265P19,   P317E03,   P312D04,   P156I03,   P165I14

 Overgo Sequences

A sequence
TGCAAAGGGGATCTGTATCTCGCA
B sequence
CCAAGAACAACTGAGGTGCGAGAT
AB sequence
TGCAAAGGGGATCTGTATCTCGCACCTCAG
Marker sequence
AAAGTTAGAAGTTGTGATCATTCTATCTCACTAATACAGAAATGGCAACC
ATCACTGCTTGCACCACAACTTCTTCGGTGGCGCGTGCCGCCCTCGTGCA
AAGGGGATCTGTATCTCGCACCTCAGTTGTTCTTGGATTACCATCAATGA
GCAAGGGTGGAAAAGTGAAATGTTCAATGGAAGGAAAGGGAAAGGGTGAA
TCAAAGTTGGGAATGGGAGAATCATTGATGGCAGCAGCAGTAGCAGCAAG
CGTGTCAAGCCCAGTTGCAATGGCTTTGGTTGATGAAAGAATGAGCACTG
AAGGAACAGGGCTACCATTTGGACTCAGTAACAGTCTTCTTGGTTGGATC
CTTTTACGTGTATTTGGTTTGATTTGGTCTCTCTACACTGTTTACACTTC
TGGACTTGATGAAGATGAAGAATCTGGAATGTCTATCAAATTTTTGTCTA
TTATTCTG
Genomic location of T0556  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1470 marker 1470
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)