SGN Marker T0562

SGN-M1472
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.11.03
Tomato EST read: TMEAD05TH
Arabidopsis best BAC match: AF149414.1
Arabidopsis position: 4.0310000
Arabidopsis identities: 0.857
Best GenBank protein hit: CAA45152.1
Evalue: 2.1e-43
Identities: 0.929
Description: ATP synthase (gamma subunit) [Nicotiana tabacum]
Comment: "g-subunit, TMEAA88TH is delta subunit"
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39359)
Chromosome
2
Position
71.00 cM
Confidence
I(LOD2)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35589
Forward primer (5'-3')
ATCCTCTGCCCTTTCTTTCC
Digested band sizes (using NsiI)
Solanum pennellii LA716: 1099
Solanum lycopersicum LA925: 980
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CAATTGCAGGGGATATGCTT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1099
Solanum pennellii LA716: 1099
Approximate temperature
55°C
  
PCR data   Exp. ID 28
Forward primer (5'-3')
Unknown
Digested band sizes (using NsiI)
Solanum lycopersicum LA925: 980
Solanum pennellii LA716: 1099
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1099
Solanum pennellii LA716: 1099
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T0562 was used as an overgo probe on plate 11 [well A7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AATCCTCTGCCCTTTCTTTCCGCT
B sequence
AAAGAGCTGACAGCAGAGCGGAAA
AB sequence
AATCCTCTGCCCTTTCTTTCCGCTCTGCTG
Marker sequence
AGACAAAACCCAATCTTTATCCCTCCCACTTCACTCTTTGGAGCAGCCAC
ATTCCTGAGCTAAAAGAAAAAACATGTCTTGTTCAAATTTGACAATGTTG
GTGTCCTCAAAACCATCTCTTTCTGAATCCTCTGCCCTTTCTTTCCGCTC
TGCTGTCAGCTCTTTTCAGCTTCCTAACCACAACCTATCAGGCCCTTCAA
ACCCCTCAAGATCATCATCAGTTATCCCTGTCCGATGTGGTCTCCGTGAT
CTGCGTGATCGAATTGACTCTGTCAAGAACACACACAAGATTACTGAGGC
TATGAAGCTTGTGGCTGCTGCTAAAGTCAGAAGAGCACAAAAAGCTGTTG
TGGGTGCGAGGCCTTTCTCTGAGACTTTGGTTGAGGTACTTTACAACATC
AATGAGCAGCTCCAGACAGATGACATTGATGTACCACTCACCAAAGTAAG
ACCTGTCAAGAAAGTGGCGTTGGTGGTTGTCACCGGTGACCGGAGTCTTT
GTGGTGGTTTTAACAACTATATCATCAAAAAAGCTGAGGCCAGGATTAGA
GATTTGAAAGCTCTTGGCCTTGATTACACTATTATCA
Genomic location of T0562  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1472 marker 1472
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)