SGN Marker T0564

SGN-M1473
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAC08TH
Arabidopsis best BAC match: AB019230.1
Arabidopsis position: 3.0470000
Arabidopsis identities: 0.754
Best GenBank protein hit: BAB02716.1
Evalue: 1.1e-21
Identities: 0.720
Description: similar to unknown [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49518)
Chromosome
5
Position
1.07 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47452)
Chromosome
5
Position
11.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42392)
Chromosome
3
Position
61.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39360)
Chromosome
5
Position
11.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10609)
Chromosome
3
Position
65.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0564 was used as an overgo probe on plate 11 [well F3]

Plausible BAC Matches:   P189E17

 Overgo Sequences

A sequence
CTTACTCCCAGAGACATGTCAGAG
B sequence
ACAGAGGAAGTTCCGACTCTGACA
AB sequence
CTTACTCCCAGAGACATGTCAGAGTCGGAA
Marker sequence
CTTTGATGAGTATCTCTTCTTTTCCTTTGATGCAACCCATAACCAGACCA
GAAATAACTTACTCCCAGAGACATGTCAGAGTCGGAACTTCCTCTGTCCT
AAGGAATGTATCCCACAACATGAGCATGAAGAAAGTTCCACGTATGATCA
CCAGAGCTAGCTCAGAACCGAGTGGCAGTAGCGATGGAGCTCTTGGACAG
AATAAGACACCATTTGGATATACGAGAAAGGATGTTATATTGATTGGAGT
TGGAGTTACACTTCTAGGGGTTGGCTTAAAGAGTGGATTGGAGTTCTTGG
GATTTGACCCTTTACAAGCTGGAAATGTCGTTCAATTAGTCCTGGTTTTG
GGTCTAACAGTTGGATGGATCTCAACATACATCTTCAGGGTTTCAAACAA
GGAAATGACGTATGCTCAACAACTACGAGACTACGAAAGCAAAGTCATGG
AGAAACGGTTAGAGAGCTTAACAGAAGCGGAATTACAAGTATTGCTTGAG
CAGGTTGAAGAAGAGAAGACCCGCTTGACTAGTGGTGAAGAGGTCAAATA
GATATTGTTTTCCTTGTAGCTACGTATCGCTGGACCTTGTTATCCCTGAA
TTATGGACTAGACCATACTGAAGTTT
Genomic location of T0564  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1473 marker 1473
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)