SGN Marker T0565

SGN-M1474
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.11.01
Tomato EST read: TMEAC09TH
Arabidopsis best BAC match: AC002330.1
Arabidopsis position: 4.0160000
Arabidopsis identities: 0.975
Best GenBank protein hit: AAC78260.1
Evalue: 2.6e-66
Identities: 0.769
Description: predicted NADH dehydrogenase 24 kD subunit [Arabidopsis thaliana]
Comment: possibly NADH-ubiquinone reductase in mitochondrion
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49519)
Chromosome
9
Position
59.71 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47453)
Chromosome
9
Position
53.65 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39361)
Chromosome
9
Position
52.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0565 was used as an overgo probe on plate 1 [well B8]

Plausible BAC Matches:   P072F09

 Overgo Sequences

A sequence
TTCGGCGATGAATGCAGTGGCTAA
B sequence
CGCAACTTCAACAACCTTAGCCAC
AB sequence
TTCGGCGATGAATGCAGTGGCTAAGGTTGT
Marker sequence
CGAACAAGGAACGTGTGTGTGGCACGCAGAACATTCATAGTGAGACTTCC
GATTTCTCCCTTTCCTCCCCAAAATCTCCATTTTCTCCGACCACCGTCTG
CTCGGAGCAATCGCCGGAGACTAAAAATGTTCGGTCGACTCGCTGCGCAA
CGTCTGAACGAGATCCGAACGTCCATCCGCCGAACTACTCAGGCATCGCG
ATCTTTTTCCACTGCACTCAACTATCACATTGATACACCGGACAACAAAA
CGGACCTTCCTTGGGAGTTTAATAATGCAAACAAGGAAAAGGTGAAAGAA
ATACTGTCTTTCTACCCATCCAACTATAAACAATCTGCAGTGATTCCTTT
GTTGGATCTTGCACAGCAGCAAAATGGAGGGTGGCTACCTGTTTCGGCGA
TGAATGCAGTGGCTAAGGTTGTTGAAGTTGCGCCAATTCGTGTATATGAG
GTTGCAACTTTCTACACGATGTTCAACAGGACAAAAGTTGGAAAATATCA
CCTTTTGGTTTGTGGCACAACACCTTGTATGATCCGTGGTTCAAGAGGTA
TCGAAGAAGCTATACTGAAGCACCTGTGAGTAAAGCGCAGTGAAGTAACT
AAGGATGGCTTATTTTCTGTTGG
Genomic location of T0565  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1474 marker 1474
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)