SGN Marker T0570

SGN-M1479
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAC20TH
Arabidopsis best BAC match: AC006836.6
Arabidopsis position: 2.0150000
Arabidopsis identities: 0.709
Best GenBank protein hit: AAD20081.1
Evalue: 8.6e-65
Identities: 0.696
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49520)
Chromosome
6
Position
39.55 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47454)
Chromosome
6
Position
58.83 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39364)
Chromosome
6
Position
53.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0570 was used as an overgo probe on plate 3 [well B9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGTAGCAGAGGAATGGTGACACT
B sequence
GGTGGTAGCCACTATTAGTGTCAC
AB sequence
CTGTAGCAGAGGAATGGTGACACTAATAGT
Marker sequence
GCAGTGAAAAGGGAAGATGAGTGCTGCTTATCCACCAGTTATAGAATGAT
CAAGATTGGGCTTTTATGTCATAGAAGAATATCATCAATAAAACATTGCT
TCAGCAACATTTTTCATCAAGATTTGCTTAGCTGTAGCAGAGGAATGGTG
ACACTAATAGTGGCTACCACCATAGACCCTGCTTCCATTGGCCCTGCATC
TGCCCTTCTAGCCATGCCTGGATGGCACCCTGGTCCTCCCATTCAGGATG
TGCCAAGTTTTGTGAATCGAGATGTAAGGCTATTGAAACATGATAGCAGC
ATTGTGAAAGAGGACCACCTGGACATGCGTTGGGAAGATACCACAGGCGA
GACGGTTGATGAGGTTATCTTTCTTAGCAAGCACACTGCTGCATCTAATC
GTCCTGCACTTACAGGTCACCCCATAGGTGTGCCTCACCTAACAGA
Genomic location of T0570  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1479 marker 1479
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)