SGN Marker T0571

SGN-M1480
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.30.03
Tomato EST read: TMEAD21TH
Arabidopsis best BAC match: AC008113.4
Arabidopsis position: 1.1330000
Arabidopsis identities: 0.814
Best GenBank protein hit: AAC95000.1
Evalue: 1.5e-36
Identities: 0.567
Description: PsbY precursor; putative photosytem II peptide [Spinacia oleracea]
Comment: photosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49521)
Chromosome
10
Position
59.32 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47455)
Chromosome
10
Position
42.59 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39365)
Chromosome
10
Position
47.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0571 was used as an overgo probe on plate 15 [well D12]

Plausible BAC Matches:   P314J23,   P278L18,   P077K02,   P019K08,   P156C03,   P270J03,   P153L05,   P224L05,   P105B17,   P266L07,   P257L15,   P276E23,   P114I01,   P179I18,   P255A10,   P277P13,   P327A15

 Overgo Sequences

A sequence
CTCTACCCTAAGCTCATGTGACTC
B sequence
TTGAGCTGCAAATGCGGAGTCACA
AB sequence
CTCTACCCTAAGCTCATGTGACTCCGCATT
Marker sequence
GGCAGCCACCATAGCTACCATGGCCGTCCTCAACGCCAAATGCTTCACCA
AAGCATCTATTAACAACCCATCAAAGCCAAAACCCATCTCTCTTCTCTCC
ATCCACAACCTCCCCAAAGGTCTCTTAACTTCAAAGCCCTCAAATTTATC
CATCCCACTCACTGGAACCGCAATTGCAGGTGCCGTTTTCTCTACCCTAA
GCTCATGTGACTCCGCATTTGCAGCTCAACAAATCGCAGAATTAGCTGAA
GGAGGAGATAACAGGGGATTAGCACTGTTGCTACCATTGATCCCGGCTCT
AGCCTGGGTTCTTTACAACATTCTTCAACCAGCACTAAACCAAATCAACA
AAATGAGGAATCAAGGAGTTATAATCGGGCTTGGTCTTACAGGGCTTGCA
GCAACAGGCTTCTTTAACACTCCAGAAGCCTCTGCTGCTACCGATATCGC
CACGATTGCAGAATCAGCAAGTGATAACAGGGGACAACTTTTGCTGATTG
TTGTAACACCTGCTTTGCTTTGGGTAGCTTACAACATTCTACAACCAGCT
NTGAATCAGATTAATAAGATGAGATCAGATTGAGGATCATCAT
Genomic location of T0571  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1480 marker 1480
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)