Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker TES1386

SGN-M14836

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50173)
Chromosome
6
Position
44.05 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48107)
Chromosome
6
Position
94.56 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45166
Forward primer (5'-3')
GTACTTACAAAAGGCCCGTGG
Accessions and product sizes
Solanum lycopersicum LA925
234
Solanum pennellii LA716
249
Approximate temperature
55°C
Reverse primer (5'-3')
TCCACCTTAAAGTGTGAGGTCTT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1386  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14836 marker 14836
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)