SGN Marker T0585

SGN-M1485
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAA46THB
Arabidopsis best BAC match: AC006416.2
Arabidopsis position: 1.0250000
Arabidopsis identities: 0.886
Best GenBank protein hit: AAD18098.1
Evalue: 6.1e-99
Identities: 0.810
Description: g5bf [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49524)
Chromosome
6
Position
41.53 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47458)
Chromosome
6
Position
76.37 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39368)
Chromosome
6
Position
71.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0585 was used as an overgo probe on plate 4 [well H7]

Plausible BAC Matches:   P132L21,   P117B06,   P300G03,   P197E12,   P246I01,   P191H06

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TCAACCCAAACAGCCTTCTTTCTC
B sequence
GGAAGAAGGAAGGAGAGAGAAAGA
AB sequence
TCAACCCAAACAGCCTTCTTTCTCTCTCCT
Marker sequence
GGCACCAAATCAACAACAACATGGCTAGTTTGGTTGCTATTCAACCCAAA
CAGCCTTCTTTCTCTCTCCTTCCTTCTTCCAATTCTGACTTCAATGGTGC
CAGATTGATCTCCTCATTTCAGTATAAGAGGAAACCATGCTTGTCAAAAG
GAGCATTGCAAGTTACAGCCTCGAGTGAAAAGAAAATCCTGATAATGGGA
GGCACGCGATTCATTGGTGTGTTCCTATCGAGACTTCTTGTGAAAGAAGG
CCACCAGGTTACTCTATTCACAAGAGGAAAAGCTCCAATCTCTCAACAAT
TGCCAGGTGAATCGGACCAGGATTATGCTGATTTCTCCTCCAAGTTATTG
CACTTGAAGGGTGACAGAATGGATTTCGATTTTGTGAAGAGCAGTCTTTC
TGCAGAGGGCTATGATGTTGTGTATGACATAAATGGACGTGAAGCAACTG
AAGTGGAGCCAATATTGGATGCATTACCTAATCTAGAACAGTACATCTAC
TGCTCTTCAGCTGGTGTATACCTTAAAACTGATTATTTACCACATTTTGA
GGTTGATGCAGGTGACCCGAAGAGTAGGCATAAAGGAAAGCTTGAGACAG
AAAGCTTGTTAGTATCACGAGATGTTAATTGGACTTCTCTAAGGCCTGTT
TATATTTATGGGCCACTTAACTACAATCCTGTTGAAA
Genomic location of T0585  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1485 marker 1485
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)