SGN Marker T0590

SGN-M1487
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAC48TH
Arabidopsis best BAC match: AC005312.2
Arabidopsis position: 2.0090000
Arabidopsis identities: 0.678
Best GenBank protein hit: AAC78524.1
Evalue: 2.9e-13
Identities: 0.744
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39370)
Chromosome
10
Position
34.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0590 was used as an overgo probe on plate 16 [well A9]

Plausible BAC Matches:   P304I01,   P104E17,   P104H22,   P239H21,   P154L01,   P115K16,   P072L21,   P066F10,   P246C08,   P210H05,   P323M08,   P203A23,   P104B17,   P217O22,   P226N06,   P029I02,   P042B06,   P238G16

 Overgo Sequences

A sequence
GTGCTGATGCATGGATTGAGAAGG
B sequence
CTTAAAGCGACCACCTCCTTCTCA
AB sequence
GTGCTGATGCATGGATTGAGAAGGAGGTGG
Marker sequence
GTATATTCAAGTGAAACATGTGCTGATGCATGGATTGAGAAGGAGGTGGT
CGCTTTAAGGCAGGATGGGTGTCCAAAAGTATGGGTTGTCACATCTGATC
ATAATCAGCAGCATGCAGCCTATGGAGCAGGGGCTTTTGTTTGGAGCTGC
AAGGCATTAATCTCTGAGATCAAAGCTTCACACAAGGAGGTTGAGAGAAT
GCTGCGGGAACATAGATCTACTTCTATGCAAGGTAAATTGTTAAAGCACA
ACCTCGCTGCAGAAGTTGTGGATGCTCTTAAGGACCTCAGGGACCAGCTT
TCTCAAAATGAGATGCGCAGATGACAAGTCTCACAAAAGGCTATGTCAGA
GACAAAACAGAATTTTAAGTCAATGGATGTTAAGTTCTAACTGCACTAGT
AACTTTGTGACAGTATATTTGGATGAGTGTTATCGATACATGTATACTAA
ATGTTTCAACCACACGTGTACATCTTGTGCTGATGATACGTTAAACATGC
AAAGATCATGTTCCTGCCTC
Genomic location of T0590  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1487 marker 1487
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)