Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker TES1665

SGN-M14901

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50238)
Chromosome
8
Position
58.26 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48172)
Chromosome
8
Position
64.54 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45246
Forward primer (5'-3')
TTGTGTCAAATCGTGGCTGT
Accessions and product sizes
Solanum lycopersicum LA925
120
Solanum pennellii LA716
117
Approximate temperature
55°C
Reverse primer (5'-3')
GGAAGATGACGTAAGAGGTAGATTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of TES1665  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14901 marker 14901
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)