SGN Marker TES1673

SGN-M14904

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50241)
Chromosome
2
Position
46.09 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48175)
Chromosome
2
Position
124.94 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45249
Forward primer (5'-3')
GTTCTATCCCCTTAACTAAACCCTAGA
Accessions and product sizes
Solanum pennellii LA716
166
Solanum lycopersicum LA925
169
Approximate temperature
55°C
Reverse primer (5'-3')
AAAATGGGATGAAAGGACCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1673  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14904 marker 14904
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)