Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

SGN Marker TES1696

SGN-M14917

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50254)
Chromosome
9
Position
1.21 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48188)
Chromosome
9
Position
14.36 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45264
Forward primer (5'-3')
GCGCATCTTGTTACTCACCA
Accessions and product sizes
Solanum lycopersicum LA925
176
Solanum pennellii LA716
179
Approximate temperature
55°C
Reverse primer (5'-3')
TCAAATCTTGGTTTCTGGGC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES1696  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D14917 marker 14917
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)