SGN Marker T0607

SGN-M1494
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAA76TH
Arabidopsis best BAC match: AB025632.1
Arabidopsis position: 5.2480000
Arabidopsis identities: 0.594
Best GenBank protein hit: BAB10260.1
Evalue: 2.3e-24
Identities: 0.469
Description: contains similarity to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39371)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0607 was used as an overgo probe on plate 6 [well G7]

Plausible BAC Matches:   P169D12,   P006K24,   P003D04,   P088D09,   P104F22,   P126E02,   P099N02,   P056I13

 Non-Plausible BAC matches

P120L04,   P171J11,   P321C23,   P042D06,   P043C23,   P190J18,   P002P15,   P298O16

 Overgo Sequences

A sequence
ATCAATGGGAGCACCAGAGTCATC
B sequence
AAGATCACATCCGGGTGATGACTC
AB sequence
ATCAATGGGAGCACCAGAGTCATCACCCGG
Marker sequence
GAAATGTTGAAGCAAATGGTTCTGTGTTTGATCCTAAGCTATCATCGGAG
CTGAGATTGTTACTCGAGCGGTATGCCAATATCTTGGGATTATCCTTCCA
GGATGCTGTAGGGATGGCTTTTGATATTTCGAGTGGTCTTAAGGATGCAG
AGGCATGGAGCTGCAATCTGATTGATTGGATGAACTTTTTTGTATTTTTA
AATGCTTGGAATCTTTATTCTCATGAAGTAGATAGAGATTCAAATAAGCA
TGGTACTACATGGCTTGTGAATTTGATTCTGAAGAAGTGTATCCTGGATA
AAGTGAGATCAATGGGAGCACCAGAGTCATCACCCGGATGTGATCTTCCT
CATTTGGTGCTATTGGTAACTGAACCTTTAGCTTGGCATATTATGGTGAT
TCAGTGTTGTGCCAGGTCATTATTGCCTTCAGGAAAGAG
Genomic location of T0607  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1494 marker 1494
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)