SGN Marker T0608

SGN-M1495
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAB78TH
Arabidopsis best BAC match: AB009050.1
Arabidopsis position: 5.2280000
Arabidopsis identities: 0.500
Best GenBank protein hit: BAB09224.1
Evalue: 1.1e-10
Identities: 0.470
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39372)
Chromosome
8
Position
70.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0608 was used as an overgo probe on plate 12 [well C11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACTCTCCAATGGCTACTCCATTGG
B sequence
AATCCATGAAGAGGCGCCAATGGA
AB sequence
ACTCTCCAATGGCTACTCCATTGGCGCCTC
Marker sequence
GCAACGTGGAGAGATTAGAGCAAGTATACAATTTTGTGGTTGTTAAACAT
TTACACCACATTTTACCCCTACAACCAAAAAAGAAGAATTGTGTGCTCTT
TACTCTCCAATGGCTACTCCATTGGCGCCTCTTCATGGATTCAATTCACC
AGCAATTCCATTAAACAAGCAAACCCAGCTCCCTATTCTTATGAAACGGA
ACAAGCAATTAAGCAAGCCAATCAACGCCGTTGCGGCCACCGATATAATT
ACTTCAGATCCAACTCAGGTGGAAATCACTTGGCAAATTGTTGCTGGATC
TTTGGCGGGTGTGACACCATTTGTGGTAGCAAGAGTCGAGTTCAGCAAAA
GAATTGGTAAAACAGAGGAAATGTGAAGTTTGTGGGGGTTCAAGACTTGT
TCTTAAGAACAAATTTTATAAGAGATGTGCTAATTGTGGGGGATTTCTTC
CTTGGCAGGCTCGGAGAAGATTCTTCACTGGCTAATAAATAGTAGTTCAT
TTGTGGAAGCTTCATACCAAGTTTGATGA
Genomic location of T0608  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1495 marker 1495
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)