SGN Marker T0615

SGN-M1499
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 4.05.03
Tomato EST read: TMEAC88TH
Arabidopsis best BAC match: AL109796.1
Arabidopsis position: 4.1540000
Arabidopsis identities: 0.812
Best GenBank protein hit: CAB81015.1
Evalue: 1.3e-31
Identities: 0.805
Description: snRNP Sm protein F-like [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49525)
Chromosome
10
Position
61.79 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47459)
Chromosome
10
Position
55.88 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39375)
Chromosome
10
Position
60.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0615 was used as an overgo probe on plate 15 [well D11]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAAAAGCTTCAATGGCGACAGTAC
B sequence
GGCTTCGGATTAACTGGTACTGTC
AB sequence
GAAAAGCTTCAATGGCGACAGTACCAGTTA
Marker sequence
CGAAAAGCTTCAATGGCGACAGTACCAGTTAATCCGAAGCCTTTTTTGAA
CAATTTGACTGGAAAGCCTGTGATGGTAAAGCTGAAGTGGGGATTAGAGT
ACAAAGGGTATCTGGTCTCTGTGGATTCATATATGAACTTGCAGCTTGCA
AATGCAGAAGAATTCACTGATGGAGTAAGCTCTGGCTCTCTCGGAGAGAT
CCTGATTAGATGTAACAATGTCCTCTATCTTCGTGGTGTACCCGAGGATG
AAGAACTGGAAGATGCTGACCGCGACTAGGAAGTGTATTAATAGTGACAA
ATTGATCAACGATTTGAATGTATCCCCGATTATGTGTTTTCTTAGGTGCT
CCTTTCTGATATATGCTGTTGGTAGTCTGGTGAAAATATTGTTGACCAAT
GATTTACGGAGCAAAATGACTAGAAAGCTGTATGATCTCCAGATTGCTTT
ATTTTTGTTATAATCACAAGCTTCAACTCGTNNAANAAAAAATAAAAAGA
AATTTAAT
Genomic location of T0615  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1499 marker 1499
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)