SGN Marker TG48

SGN-M15

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1500
Vector
pUC
Cutting Site
EcoR1/BamH1
Drug Resistance
AMP
Image
Forward sequence
TAAACATTTTTATGGGGTATATGATTCCTCTCCATCCCCTTTTCTGTTCATTTTACTTGAGAGCTAGATAGCTACAACAGTCTTCACCAG
GCTAGTACAAAATCATCACCACCATCAAACGATTTTTTCCTCTCAATCAAAGGGCTTAATATCATACTTAATAAGCCAGATTTCACTACC
CCCAAAAGAGAAGAAGTCAGAAGTTCTAAAAGTTTAAAACAATTATGGAACCTAACCATGAAATATGCATGTATAAAGATAATAAATCTT
ATATTTATTATTTTGCTATAAACAACATGTATTAGTGTAATTGGATGAACCAACTTGCCTGATCTAGGGCAAAATCAAACATGTAGCGCA
AATGATGTTGCACGATGTTCTTGCCGGTGGCAGATTGGTAGGCTAAATCGAATGCCTGAGCTGCTGAATACACAAATCCAATGACATTCA
CTGACATACAGTACCTGCAACGTTATTCACCTACCAATATTATCATTCATAACTATACCTGCCTAACACATTTATTCATTGCTCTGAAAG
AGTGAAACTTAATGCGCTGCAGAATTAATTCAGTCAATGTAAAGAGAACAAGTGACAA
Reverse sequence
TTATATTTAATAACAATTTAATTTTTAAAATATTTATTTACTTAAAACCACAAAAACGTTATAATTTATTTAAATTTTTAGATCACAGTT
TTCATTTTTTTTGGAATACTGTACTCGTATTTAGTAGTAGTCCTAAATATAGAGCTTTCACAAATTCAGACGTGGAAGACGAAAGTGGAA
ACCGCCAAAACTATCATTATCGCAGAGACCTCATCTTTCAACTTCCATTCATTATTCTATTTTCCGTTTCACTCCATTTTCATACACCCA
ATCCCATTTTTGTAGCAGCAGTGTTCTGTTTCTTCTTCATGGAATTGAATCATACCAAGCAGACTCTGCAAACGGCTATGGAGAATGAAC
AGCAGCATCTCTCCCTCTCTGAATCAGATTCTACTGATTCTGAACCTGAGAAAGCTATTACTTTCTCCTCCCCAGCTCGTTTTCATAGCG
GCTCCGATTCTGATCATTCCACTAAGTTCCAAACAGATAAAGCTACTAATCCCTCTACCGTCAATGGCGATTCTACTAAGGCGCAATCTC
AGCCGAGGTCATCAATTTCCTCCGATTCAGATGATTTTAGTAAGTGTGGAGAACATAAAGT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U153699431 (71.7% of RFLP seq)-
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53336)
Chromosome
2
Position
98.43 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_2 MQTL_2_Late_blight_2 MQTL_3_Late_blight_2
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50399)
Chromosome
2
Position
44.04 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48332)
Chromosome
2
Position
101.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40060)
Chromosome
2
Position
92.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Pepper-AC99   
Map version
34 (location: 7740)
Chromosome
2
Position
122.35 cM
Confidence
uncalculated
Protocol
RFLP


Pepper-AC99

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7737)
Chromosome
2
Position
79.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7743)
Chromosome
2
Position
47.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7742)
Chromosome
2
Position
73.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG48 was used as an overgo probe on plate 6 [well B6]

Plausible BAC Matches:   P236E02,   P140C03,   P060A20,   P214L23,   P016A12,   P309B06,   P018N23,   P189P05,   P265F24,   P280C08,   P269E04

 Overgo Sequences

A sequence
GAGAGCTAGATAGCTACAACAGTC
B sequence
GTACTAGCCTGGTGAAGACTGTTG
AB sequence
GAGAGCTAGATAGCTACAACAGTCTTCACC
Marker sequence
TAAACATTTTTATGGGGTATATGATTCCTCTCCATCCCCTTTTCTGTTCA
TTTTACTTGAGAGCTAGATAGCTACAACAGTCTTCACCAGGCTAGTACAA
AATCATCACCACCATCAAACGATTTTTTCCTCTCAATCAAAGGGCTTAAT
ATCATACTTAATAAGCCAGATTTCACTACCCCCAAAAGAGAAGAAGTCAG
AAGTTCTAAAAGTTTAAAACAATTATGGAACCTAACCATGAAATATGCAT
GTATAAAGATAATAAATCTTATATTTATTATTTTGCTATAAACAACATGT
ATTAGTGTAATTGGATGAACCAACTTGCCTGATCTAGGGCAAAATCAAAC
ATGTAGCGCAAATGATGTTGCACGATGTTCTTGCCGGTGGCAGATTGGTA
GGCTAAATCGAATGCCTGAGCTGCTGAATACACAAATCCAATGACATTCA
CTGACATACAGTACCTGCAACGTTATTCACCTACCAATATTATCATTCAT
AACTATACCTGCCTAACACATTTATTCATTGCTCTGAAAGAGTGAAACTT
AATGCGCTGCAGAATTAATTCAGTCAATGTAAAGAGAACAAGTGACAA
Marker Submitted By 
Name: Molly Jahn
Organization: Cornell University
Genomic location of TG48  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15 marker 15
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)