SGN Marker T0616

SGN-M1500
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAC89TH
Arabidopsis best BAC match: AC005309.2
Arabidopsis position: 2.2550000
Arabidopsis identities: 0.666
Best GenBank protein hit: AAC63654.1
Evalue: 7.0e-71
Identities: 0.563
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39836)
Chromosome
9
Position
60.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0616 was used as an overgo probe on plate 16 [well C1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGGAACTCTCAGAGCTTGGGATAC
B sequence
CTGCTGAAAAGACCTGGTATCCCA
AB sequence
TGGAACTCTCAGAGCTTGGGATACCAGGTC
Marker sequence
TGCGAGCCGGAGTTTTCTTCACTGTTGACAGAGAGAGAAGAAGAAGAAGA
AGAAAATGGATGGCGCAGAGGAGATGGAAATAGAGGGACAATCGCAGTTG
CTTCCAATATGCAACGATTCTAAGCGATTTGGTATCAAAAACTCTATTCA
GACTAACTTCGCCGACGATTACGTTTTCCAAATTGTTCCCAAGAATGATT
GGACATCAATGGCGGTATCACTCTCAACTAATGCGATTAAGTTGTACTCT
TTAGCTACTGCACAGTACATTGGGGAATGTAATGGTCATTCTTCAACGAT
TAATCAAATTTCCTTTTCGGATCCTTCATCGCCACATGTGCTGCATTCTT
GTTCTTCTGATGGAACTCTCAGAGCTTGGGATACCAGGTCTTTTCAGCAG
GTGTTTTCCCTAAATGCTGGCCCTTCTCAAGAGATATTTAGTTTCTCCTT
TGGTGGACCTAATCATAATCTGCTTGCTGCCGGGTGTAATTCTCAGATAC
TCTTTTGGGATTGGAGGACCAAGCGTCAGGTTGCGTGCTTGGAGGAATCT
CATACGGAAGATGTTACTCAGGTGCACTTTATTCCAGGCTATGATGATAG
ACTCATTTCTGGATCAGTTGATGGATTAATGTGTCTATTTGATACTGGGG
GAGATATCAACGATGATGATCAAATGGTATCGGTAC
Genomic location of T0616  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1500 marker 1500
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)