SGN Marker TES2042

SGN-M15002

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50338)
Chromosome
12
Position
4.91 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48273)
Chromosome
12
Position
48.92 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45364
Forward primer (5'-3')
GTTTTTCCTCTCTGTAAAACCCC
Accessions and product sizes
Solanum lycopersicum LA925
261
Solanum pennellii LA716
264
Approximate temperature
55°C
Reverse primer (5'-3')
CGATTCCCCGTTTTAGACAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TES2042  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15002 marker 15002
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)