Notice: Please give us important feedback on the future of SGN using this survey: https://www.surveymonkey.com/r/VJTRHVC

SGN Marker TGS131

SGN-M15021

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50432)
Chromosome
5
Position
32.97 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48364)
Chromosome
5
Position
75.82 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45721
Forward primer (5'-3')
GATACACACGTGCAGCGCAT
Accessions and product sizes
Solanum lycopersicum LA925
126
Solanum pennellii LA716
148
Approximate temperature
55°C
Reverse primer (5'-3')
TCATTGATTGTAGATTCAAACCC
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Related Markers  

Related Genotyped Markers: These markers have been genotyped and share a name with this marker

Genomic location of TGS131  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15021 marker 15021
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)