SGN Marker TGS155

SGN-M15028

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50439)
Chromosome
5
Position
56.01 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48371)
Chromosome
5
Position
81.80 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45765
Forward primer (5'-3')
CAAAAAGGACAACTCGAGCC
Accessions and product sizes
Solanum pennellii LA716
174
Solanum lycopersicum LA925
185
Approximate temperature
55°C
Reverse primer (5'-3')
GAACTTCTTTTCCTTCTTCAGCA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS155  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15028 marker 15028
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)