SGN Marker TG393

SGN-M151

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1200
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG393 image not available
Forward sequence
ACTGACTAAGCTGCTGGATTTGATTAGCCGAAGGAATTTACTTTTGGTTACATCTTGCTCCATCACCTTTGTCTTTATCTAGGTCAATCT
TGTACCATAGATGCAAATAACACTATGAACAGATTAACAATGTCTTGAGGAGGATTAGGCTGTCAACAGCCTGCATAATAACAGGAACAA
CATTGGCGTTTGTTTGCATCAGTTACTGTGACTCTGATTAAAGGAGAAAATGTGGCATCCTCTGCTTATACTGTCAGTGTGTATACTTGT
CAGGTTAAGTTGGTTGCTATAATCTTTAATAATTCTTGATTTTGTGGTTGTTTCTGAAGTAAATTGATATGTGGGCCTTTGAGCTGGAGG
AGATGGTACTTTAGCTATTCACTAACAATCGTTTACCTTAAAAATGTTATTCTGTAAGTATCTAACCAAATTCTGATCAC
Reverse sequence
TGCAGACACCAAAGAAACAATTGGTTATATAAAAAACAATCCACAATCATTCTCTATAGAAGTCACGCAAAGACACTACATAACCTCCAA
GTGCAATGAAGAGGATGCAGAATAAGAAGCTCAGAACTTCCAAAAGAAAAGGTGACTGAAAATAAGTTTGCTGAAAAGGTACAAGGCAAG
TTCTAATTCTCAACTAGCTTTAGGTATACACTAAAGAAAAGGAAAATAAATTCCAAACAGAAGTTTCCATCCTACCTAGTACATAAAAGA
AAAAGGTAAAAAGGAACATATGGAAGTGTTCCCCTGTTACCTAAACTTTTGGTGATAAACAGTAATCATGATTACCCCCACCTCACACAC
CACCACTACAGCACAAAAATTAGAAATGTTGTATGGACCATGATCAACCAGCCAAGAATCCCAGAAGGAGAATAAAGGAGTTCTCTTAAT
CACAAGAGGAGAATATCATCTACT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53294)
Chromosome
11
Position
48.42 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43865)
Chromosome
11
Position
99.50 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43608)
Chromosome
11
Position
84.50 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43327)
Chromosome
11
Position
88.10 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42453)
Chromosome
12
Position
71.80 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40868)
Chromosome
11
Position
97.00 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40025)
Chromosome
11
Position
103.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000

Map: Tomato-EXHIR 1997   
Map version
32 (location: 8318)
Chromosome
11
Position
68.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXHIR 1997

Map: Eggplant-LXM 2002   
Map version
29 (location: 8320)
Chromosome
12
Position
74.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8319)
Chromosome
11
Position
88.50 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8317)
Chromosome
11
Position
47.70 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8324)
Chromosome
11
Position
107.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 14012
Forward primer (5'-3')
TGGATTTGATTAGCCGAAGG
Digested band sizes (using DpnII)
Solanum pennellii LA716: 325
Solanum lycopersicum LA925: 400
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCAAGAATCCCAGAAGGAGA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 14012
Forward primer (5'-3')
TGGATTTGATTAGCCGAAGG
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 400
Solanum pennellii LA716: 325
Mg+2 concentration
Unknown
Reverse primer (5'-3')
CCAAGAATCCCAGAAGGAGA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 750
Solanum lycopersicum LA925: 750
Approximate temperature
55°C
  
PCR data   Exp. ID 145
Forward primer (5'-3')
Unknown
Digested band sizes (using DpnII)
Solanum pennellii LA716: 325
Solanum lycopersicum LA925: 400
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 750
Solanum pennellii LA716: 750
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG393 was used as an overgo probe on plate 3 [well E7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ACAATGTCTTGAGGAGGATTAGGC
B sequence
ATGCAGGCTGTTGACAGCCTAATC
AB sequence
ACAATGTCTTGAGGAGGATTAGGCTGTCAA
Marker sequence
ACTGACTAAGCTGCTGGATTTGATTAGCCGAAGGAATTTACTTTTGGTTA
CATCTTGCTCCATCACCTTTGTCTTTATCTAGGTCAATCTTGTACCATAG
ATGCAAATAACACTATGAACAGATTAACAATGTCTTGAGGAGGATTAGGC
TGTCAACAGCCTGCATAATAACAGGAACAACATTGGCGTTTGTTTGCATC
AGTTACTGTGACTCTGATTAAAGGAGAAAATGTGGCATCCTCTGCTTATA
CTGTCAGTGTGTATACTTGTCAGGTTAAGTTGGTTGCTATAATCTTTAAT
AATTCTTGATTTTGTGGTTGTTTCTGAAGTAAATTGATATGTGGGCCTTT
GAGCTGGAGGAGATGGTACTTTAGCTATTCACTAACAATCGTTTACCTTA
AAAATGTTATTCTGTAAGTATCTAACCAAATTCTGATCAC
Genomic location of TG393  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D151 marker 151
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)