SGN Marker T0634

SGN-M1511
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAG31TH
Arabidopsis best BAC match: AB007645.1
Arabidopsis position: 5.3030000
Arabidopsis identities: 0.939
Best GenBank protein hit: BAB09022.1
Evalue: 6.6e-71
Identities: 0.787
Description: similar to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39381)
Chromosome
2
Position
130.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35591
Forward primer (5'-3')
TTCGCAGTTTTGGGAGTACC
Digested band sizes (using RsaI)
Solanum lycopersicum LA925: 400+850
Solanum pennellii LA716: 425+900
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
GCGCAACAGTTCTTCTTTCC
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
PCR data   Exp. ID 36
Forward primer (5'-3')
Unknown
Digested band sizes (using RsaI)
Solanum pennellii LA716: 425+900
Solanum lycopersicum LA925: 400+850
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1300
Solanum pennellii LA716: 1300
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T0634 was used as an overgo probe on plate 11 [well H4]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
GGTTAGTCACTTTCGCAGTTTTGG
B sequence
GCAGCAATAGGTACTCCCAAAACT
AB sequence
GGTTAGTCACTTTCGCAGTTTTGGGAGTAC
Marker sequence
CCTACGTCTCGGGGGACTTTGGTTAGTCACTTTCGCAGTTTTGGGAGTAC
CTATTGCTGCTGCAAGCTTCAATCCTTCAAAGGATCCTTTAAGATTTCTC
CTGGCTGCAAGTACGGGGACTCTTTTTCTTGTTGCACTGATTGTCCTAAG
AATTTATCTGGGATGGAGCTATGTTGGAGATAGGCTTTTATCAGCAGTTA
TACCTTATGAAGAGACTGGATGGTATGATGGGCAGATGTGGGTGAAGCCC
CCAGAGATCTTAGCTCGGGATAGGCTGTTGGGATCTTATAAGGTGAAACC
AGTCATTAAAATGCTGAAGCAAACGCTAGTTGGAACAGGGGCTTTGCTTG
TTGCAGCAGTCTCATTATTCATATTTGCAACACCAGTAGAAGATTTTTTC
CGCAATACTTTCACAACAAACGAGAACTCATTGAGTTCCACCTCAACAAA
CAGCACAAATAAACTAGGCATCAGGAAAGAAGAACTGTTGCGCTTGCCCC
TGGAAGTCAAGG
Genomic location of T0634  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1511 marker 1511
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)