SGN Marker T0637

SGN-M1513
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAE37TH
Arabidopsis best BAC match: AF128393.1
Arabidopsis position: 4.0330000
Arabidopsis identities: 0.793
Best GenBank protein hit: AAF27915.1
Evalue: 4.1e-64
Identities: 0.805
Description: DES-1-like transmembrane protein [Arabidopsis thaliana]
Comment: similar to DES-1 required for the initiation of meiosis in Drosophila spermatogenesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49530)
Chromosome
10
Position
3.06 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47464)
Chromosome
10
Position
24.00 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42393)
Chromosome
4
Position
52.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39383)
Chromosome
10
Position
24.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 10683)
Chromosome
4
Position
30.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002
Overgo hybridization and physical mapping 
T0637 was used as an overgo probe on plate 15 [well C12]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TGAACCTCATGCTTCGTCGTACAG
B sequence
TGAGAGAGGATCTGTCCTGTACGA
AB sequence
TGAACCTCATGCTTCGTCGTACAGGACAGA
Marker sequence
GGTGTTAGAATGGCTAATGATTTCTTTTGGTCATATACAGATGAACCTCA
TGCTTCGTCGTACAGGACAGATCCTCTCTCAGTACCCTCAAATCAAACAG
CTTTTTGGTCCTGACCCTTTTGCTTTTCTCAAGATATCAGGAGTTGTTTT
GCTTCAGCTTTGGACAGCTACCTTCCTCCATGATGCAACGTGGTTGAAGA
TATTGATAGTCGCATACTTCTTTGGCTCTTTTCTGAACCATAATCTCTTC
CTGGCCATTCATGAACTAAGTCACAACCTTGCTTTCTCTACTCCAACCTA
CAACCGTTGGCTTGGAATTTTTGCCAACCTTCCCGTTGGTGTACCCATGT
CTGTAACCTTCCAAAAGTATCACCTTGAGCACCATCGCTTCCAAGGAGTT
GATGGAATTGATATGGACATCCCGAGCCAAACTGAAGCCCATGTAGTGGA
AAATGTTCTTGCAAAGTCTATATGGGTCATTCTCCAACTA
Genomic location of T0637  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1513 marker 1513
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)