SGN Marker TGS645

SGN-M15157

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50568)
Chromosome
5
Position
60.23 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48500)
Chromosome
5
Position
79.02 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 46206
Forward primer (5'-3')
GTGAATCCATTGAGCTTTGAGG
Accessions and product sizes
Solanum lycopersicum LA925
279
Solanum pennellii LA716
282
Approximate temperature
55°C
Reverse primer (5'-3')
CCAATGAGAGGGATTTTCAGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS645  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15157 marker 15157
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)