SGN Marker TGS646

SGN-M15158

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48501)
Chromosome
4
Position
37.06 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 46207
Forward primer (5'-3')
GATCAAAAAGCGTATCGGTGG
Accessions and product sizes
Solanum lycopersicum LA925
170
Solanum pennellii LA716
168
Approximate temperature
55°C
Reverse primer (5'-3')
CCAACTTCCTAAACCATTGTG
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS646  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15158 marker 15158
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)