SGN Marker T0641

SGN-M1517
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAE48TH
Arabidopsis best BAC match: AL050399.1
Arabidopsis position: 4.0720000
Arabidopsis identities: 0.564
Best GenBank protein hit: CAA56189.1
Evalue: 4.7e-68
Identities: 0.977
Description: unnamed protein product [Nicotiana tabacum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39384)
Chromosome
9
Position
38.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0641 was used as an overgo probe on plate 15 [well G6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAACCCAAAGCCGAAAACAGAGTG
B sequence
ATGATCGAGAAAGCGCCACTCTGT
AB sequence
GAACCCAAAGCCGAAAACAGAGTGGCGCTT
Marker sequence
TTGAGCTTGAAAATGAGAAGGAGAGGAGTTTGAGGGTGGCCAATCTAATT
GGTTTTGAAGTTGAACCCAAAGCCGAAAACAGAGTGGCGCTTTCTCGATC
ATCACTTCTCTCAGAGTTGGTGTCCAAAGGTGTGATGTCCTGTGTCACTC
AAGAAGTGAAAGATCTTTATCATCTGTTAGAAAATGAGTTTCTTCCTTTG
GATCTGGCACTGAAGGTGCAGCCCATATTGAATAAAATATCAAAACTTGG
TGGTAAGCTGTCTTCAGAATTCTTCGGTTCCTGAAGTGCAACTGTCTCAG
TATGTTACTGGCTTAGAAAAGCTTGCTACTCTGAGGTTGCTCCAGCAGGT
CTCTCAAGTGTATCAGACAATCCAGATTGATAACATATCTAAGATGATCC
CATTCTTCGACTTCACCGCTATTGAGAAAATATCACTTGATGCGGTTAGG
CGTAATTTTCTTGCCATCAAAGTCGATCACATGAAGGGAGCTGTCTTCTT
TGGCAGACAGAATGAATCAGGCTGACTGAGCTT
Genomic location of T0641  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1517 marker 1517
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)