SGN Marker TGS725

SGN-M15172

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50582)
Chromosome
10
Position
6.38 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48515)
Chromosome
10
Position
34.26 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 46222
Forward primer (5'-3')
GCATTCTACTCAAACAAACAATAACACA
Accessions and product sizes
Solanum lycopersicum LA925
172
Solanum pennellii LA716
171
Approximate temperature
55°C
Reverse primer (5'-3')
ATAAACAGGCCGCAGCATTA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS725  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15172 marker 15172
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)