SGN Marker T0649

SGN-M1522
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAH49TH
Arabidopsis best BAC match: AB025639.1
Arabidopsis position: 3.0800000
Arabidopsis identities: 0.846
Best GenBank protein hit: BAB01322.1
Evalue: 1.9e-72
Identities: 0.775
Description: "dehydrogenase-like protein [Arabidopsis thaliana] /e-24, 3-hydroxyisobutyrate dehydrogenase [Aquifex aeolicus]"
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39840)
Chromosome
9
Position
50.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0649 was used as an overgo probe on plate 6 [well F6]

Plausible BAC Matches:   P321O15,   P175E06,   P258K16,   P321O23,   P139D08,   P258C16,   P121N13,   P210L12

 Overgo Sequences

A sequence
GAAAAGCAATGGCGGTGAACTTGC
B sequence
TTGAAACCATGGCGCAGCAAGTTC
AB sequence
GAAAAGCAATGGCGGTGAACTTGCTGCGCC
Marker sequence
GAATGGAGGAAATAGGGTTTCTAGGGATTGGTATTATGGGAAAAGCAATG
GCGGTGAACTTGCTGCGCCATGGTTTCAAGGTTACTGTTTGGAATCGCAC
CCTCTCCAGGTGTGATGAGCTAGTGCAACATGGAGCCTCTGTTGGAGAAA
CTCCTGCAGCAGTAATCAAGAAATGCAAGTATACAATTGCAATGTTGTCT
GATCCAGCTGCAGCTCTTTCAGTGGTTTTTGACAAACACGGAGCACTTGA
GCACGTATGTGCCGGAAAGGGCTATATAGACATGTCAACCGTTGATGCTG
ATACTTCTTCACAGATTAGCCAGGCCATTACATCAAAGGGTGGTTCATTC
CTTGAAGCTCCAGTTTCAGGGAGCAAAAAGCCAGCTGAAGATGGACAACT
AGTAATCCTAGCAGCTGGTGACAAGGATCTGTACGATCAAGTAGTACCTG
CTTTTGATGTCCTGGGAAAGAAATCTTTTTTCTTGGGAAAGATTGGGAAT
GGAGC
Genomic location of T0649  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1522 marker 1522
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)