SGN Marker T0650

SGN-M1523
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 98
Tomato EST read: TMEAG54TH
Arabidopsis best BAC match: AC005275.1
Arabidopsis position: 4.0190000
Arabidopsis identities: 0.668
Best GenBank protein hit: AAD11582.1
Evalue: 7.6e-57
Identities: 0.668
Description: GH3-like protein [Arabidopsis thaliana]
Comment: "GH3 is cotton lipid transfer protein, compare with TFBAA15THB (same?)"
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39386)
Chromosome
10
Position
23.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0650 was used as an overgo probe on plate 15 [well D10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCAAGTCAAGAGCTGAGCTAGTAG
B sequence
GCATGGCTTGTGAAGTCTACTAGC
AB sequence
GCAAGTCAAGAGCTGAGCTAGTAGACTTCA
Marker sequence
CCAAACTCAACTTTATATGCAGGAGAAAGCTGATATTAACAGTAAACATC
GATAAGAATACTGAACAGGACCTTCAGTTAGTGGTGGAGAGAGGTTCGCG
AATACTAATAAGCAAGTCAAGAGCTGAGCTAGTAGACTTCACAAGCCATG
CAAATGTATCAAAAAGACCAGGCCATTATGTGATCTATTGGGAAATCAAA
GGTGATGTTGATGAAAATGTTTTTGGAGAGTGTTGTAGGGAGATGGATGC
ATCTTTTGTTGATCATGGATATGTTGTATCAAGAAAAACAAATTCAATTG
GACCATTAGAACTTTGCATTGTGGAAAGAGGTACTTTCAAGAAGATTTTG
GAACATTTTATTGGAAATGGAGCAGCATTAAGCCAATTCAAGACTCCAAG
ATGCACTAGCAACCAAGTACTATTAAGAATCCTTAATGTATGTACCATTA
AAAGGTTTTATAGCACAGCTTATGGTTGATACAATGTTTTTGTAACATAA
GTGATCAATTTGCATTGATATTTACTTTATTT
Genomic location of T0650  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1523 marker 1523
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)