SGN Marker T0656

SGN-M1527
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMEAG68TH
Arabidopsis best BAC match: AB024035.1
Arabidopsis position: 5.2380000
Arabidopsis identities: 0.902
Best GenBank protein hit: BAA97034.1
Evalue: 8.6e-46
Identities: 0.902
Description: similar to unknown [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49532)
Chromosome
7
Position
48.53 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47466)
Chromosome
7
Position
26.68 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39387)
Chromosome
7
Position
23.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0656 was used as an overgo probe on plate 8 [well D6]

Plausible BAC Matches:   P303O08,   P267O16,   P245M14,   P026P16,   P310O01,   P201O12,   P287L01,   P302K10,   P124P24

 Non-Plausible BAC matches

P302K09,   P244L05,   P191O01,   P015O12,   P145I04,   P304P17,   P126C11,   P273I22,   P173F19,   P188B22

 Overgo Sequences

A sequence
AATGGCTTCTCTGCTGAACCCACC
B sequence
TTGAGGCAGAGTGAGAGGTGGGTT
AB sequence
AATGGCTTCTCTGCTGAACCCACCTCTCAC
Marker sequence
TTCAATGGCTTCTCTGCTGAACCCACCTCTCACTCTGCCTCAAAACAAGC
TGAACCCTGGGGGTGTCTTATCTGTATCTACTAGTGGAATACCAAACAAA
ATTTTTCAACCATCTTCAACACGATGGAGCCACAGGCGGCGTTTGATGAC
GAGAGCTAAACCATCGGTGGAAATGGATATGCTGGCAAAAGATTCTGTAG
GCACCGACGCTGTTGATGATAAGGGTGATCTTTCTTTTTCATCTCAAGCA
GCACAGTCAAAATTTTCATTTGCAGATTTTGGAGTTGTTTGCATGCACCA
CGTTGGGATACTATGTGAAAACCTTGAGAGGTCCTTAGACTTTTACCAGA
ACATTCTTGGGCTAGAAATAAATGAGGCAAGACCACATGACAAACTTCCC
TATAGAGGTGCTTGGTTGTGGGTGGGTTCTGAGATGATACATCTAATGGA
GCTTCCAAATCCAGATCCTTATACTGGTAGGCCTGAGCACGGNGGCAGAG
ACCGTCATACTTGCATAGCAATTCGCGATGTGTCTAAGCTGAAAGCTATT
Genomic location of T0656  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1527 marker 1527
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)