SGN Marker T0659

SGN-M1528
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 2.11.01
Tomato EST read: TMEAE73TH
Arabidopsis best BAC match: AC005275.1
Arabidopsis position: 4.0190000
Arabidopsis identities: 0.886
Best GenBank protein hit: CAA46808.1
Evalue: 5.2e-77
Identities: 0.878
Description: Rieske FeS [Nicotiana tabacum]
Comment: Chloroplast PSI reaction center complex
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39841)
Chromosome
12
Position
11.00 cM
Confidence
F(LOD3)
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35613
Forward primer (5'-3')
AATGGTCATGGAATGGGAAA
Digested band sizes (using AccI)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
TGCCAAGGATAAAGGAGCAG
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1100
Solanum lycopersicum LA925: 1100
Approximate temperature
50°C
  
PCR data   Exp. ID 147
Forward primer (5'-3')
Unknown
Digested band sizes (using AccI)
Solanum pennellii LA716: 900
Solanum lycopersicum LA925: 1100
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 1100
Solanum pennellii LA716: 1100
Approximate temperature
50°C
  
Overgo hybridization and physical mapping 
T0659 was used as an overgo probe on plate 3 [well C12]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
TGGGTGCACTTGCTTTACCAACTG
B sequence
GGTACAAGCATTCCACCAGTTGGT
AB sequence
TGGGTGCACTTGCTTTACCAACTGGTGGAA
Marker sequence
GCTTCTTCCACTCTTTCTCATGTAACTCCTTCTCAGCTATGCTCAAGCAA
AAGTGGTATTTCATCGGTTTCACAAGCCTTGCTTGTGAAGCCGATGAAGA
TTAATGGTCATGGAATGGGAAAGGATAATAAGAGGATGAAAGTGAAATGT
ATGGCAGCTAGTATTCCAGCAGATGATAGAGTGCCTGATATGGAGAAAAG
GAATCTTATGAATTTGCTTTTATTGGGTGCACTTGCTTTACCAACTGGTG
GAATGCTTGTACCTTATGCTACTTTCTTTGCACCTCCTGGCTCAGGAGGT
GGTAGTGGTGGTACCCCTGCCAAAGATGCTAATGGCAATGATGTTGTTGT
GACTGAATGGCTCAAAACTCATGCACCTGGAACTCGAACCCTCACACAAG
GACTAAAGGGAGATCCTACTTACCTTGTTGTGGAGAACGATGGAACACTC
GCGACCTATGGTATCAATGCTGTGTGCACTCACCTTGGTTGTGTCGCGCC
GTGGAATACTGCTGAGAACAAGTTCATTTGCCCTTGCCATGGATCTCAAT
ACAACAATCAAGGGAAAAGTTGTTAGAGGACCTGCTCCTTTATCCTTGGC
ATTGGCTCATGCAGACGTTGATGATGGGAAA
Genomic location of T0659  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1528 marker 1528
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)