SGN Marker TGS1929

SGN-M15358

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50768)
Chromosome
9
Position
62.16 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48701)
Chromosome
9
Position
59.15 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45804
Forward primer (5'-3')
GCCCGGTCTCATATGGAACAT
Accessions and product sizes
Solanum lycopersicum LA925
230
Solanum pennellii LA716
221
Approximate temperature
55°C
Reverse primer (5'-3')
TCTTCAGTTTTGCCGTTGAA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS1929  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15358 marker 15358
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)