Notice: The SGN server upgrade is complete. Please let us know if you find any issues. :-)

SGN Marker TGS2149

SGN-M15402

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50811)
Chromosome
9
Position
41.78 MB
Confidence
uncalculated
Protocol
SSR


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48745)
Chromosome
9
Position
52.28 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45854
Forward primer (5'-3')
GTCCTCTTCTTCATCTTCTTCGTT
Accessions and product sizes
Solanum lycopersicum LA925
106
Approximate temperature
55°C
Reverse primer (5'-3')
CAAGGACTAGCAGCCAAACA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS2149  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15402 marker 15402
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)