Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T0687

SGN-M1543
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMECX02TH
Arabidopsis best BAC match: AL096859.2
Arabidopsis position: 3.1090000
Arabidopsis identities: 0.618
Best GenBank protein hit: CAB51187.1
Evalue: 7.3e-20
Identities: 0.583
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49538)
Chromosome
6
Position
0.76 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47472)
Chromosome
6
Position
0.84 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39392)
Chromosome
6
Position
2.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0687 was used as an overgo probe on plate 1 [well E2]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCAGCTGTTGAAAAGGCTAACGAG
B sequence
CTTGAGCGTCTGATTCCTCGTTAG
AB sequence
TCAGCTGTTGAAAAGGCTAACGAGGAATCA
Marker sequence
CTCATCTCTCAGCTCAAATCAGCTGTTGAAAAGGCTAACGAGGAATCAGA
CGCTCAAGTTGCTACCGTTAGGGGACAGGCCAAGGCTAAAAATTTGCCTG
CTCAGAAAGCAGTGGTGAAAACTCCTCCAAGGAAACCATTTGCTTCGAAA
ACGAAGAAGGAGGCTCCGAAACCAGCTAAACAAACAGAGGTTGCTTCAAC
AGAGAAGAGGAAGATTTTTGGTGGACTGTTTCAACAAGAAACCATCTATG
TTGATGACTAAGATGAATGAATAA
Genomic location of T0687  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1543 marker 1543
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)