SGN Marker T0693

SGN-M1545
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TMECX76TH
Arabidopsis best BAC match: AB006707.1
Arabidopsis position: 5.1240000
Arabidopsis identities: 0.727
Best GenBank protein hit: BAB08519.1
Evalue: 9.2e-23
Identities: 0.627
Description: folylpolyglutamate synthase-like protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49539)
Chromosome
6
Position
32.07 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47473)
Chromosome
6
Position
31.78 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39393)
Chromosome
6
Position
25.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T0693 was used as an overgo probe on plate 2 [well D10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
AGGTGTGAAGTTACGCATGCTTGG
B sequence
CTGAAGTTGGTGAGCTCCAAGCAT
AB sequence
AGGTGTGAAGTTACGCATGCTTGGAGCTCA
Marker sequence
TTGAGAAGGACTATGATCTGTCTATTGAACTTCTAGGTGTGAAGTTACGC
ATGCTTGGAGCTCACCAACTTCAGAACGCTGTAACTGCTACATGTGCAGC
ATTATGCCTTAATAAGCAAGGATGGAGTTTGTCCAGTGGGGCTATTCGTG
CTGGTCTGGAGAGTGCATTTTTGCAAGGCAGAACCCAAATATTGTCTTCA
GAAGAAGCTAAGTTACTTGGAGTATCTGGAGCAACTGTACTACTTGATGG
AGCACATACGAAGGAATCTGCCAGGGCTTTGGC
Genomic location of T0693  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D1545 marker 1545
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)