SGN Marker TGS2479

SGN-M15473

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48816)
Chromosome
12
Position
68.55 cM
Confidence
uncalculated
Protocol
SSR


Kazusa F2-2000 genetic map

PCR data   Exp. ID 45935
Forward primer (5'-3')
GTGAATTCATTGCATCTCAAAAA
Accessions and product sizes
Solanum lycopersicum LA925
269
Approximate temperature
55°C
Reverse primer (5'-3')
CTTGTGTGAGGGGTTCAGGT
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  
Genomic location of TGS2479  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D15473 marker 15473
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)